摘要：

The nucleotide sequence of the low molecular weight ribosomal RNA (5 s RNA) of Escherichia coli has been studied using 32P-labelled RNA and paper fractionation techniques. This is shown to be: pUGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU OH. † † In this paper one-letter symbols for the nucleosides have been used as recommended in J. Biol. Chem. (1966), 241, 527. Similarly an abbreviation such as 7MeG has been used for 7-methyl-guanosine. We have also followed these recommendations by using hyphens to replace p in short known sequences but for reasons of space have omitted the hyphens altogether in known sequences of more than six nucleosides. Unless otherwise stated the oligonucleotide fragments mentioned in this paper have a 3′-terminal phosphate group and a free 5′-terminal hydroxyl group. There are two major species of 5 s RNA which differ by a base in only one position. A new two-dimensional procedure suitable for fractionating oligonucleotides up to 25 residues long is described.

展开